DETECTION OF A 24 BP SEQUENCE COMPLEMENTARITY TO THE HEPATITIS E VIRUS (HEV) RNA

di Redazione

Paleopatologia

Articoli
> Paleopatologia

Versione stampabile  Dimensione testo: Piccolo | Medio | Grande

I. Marota, G. Fornaciari°, F. Rollo


Dept. of Molecular, Cell and Animal Biology, School of Specialization in
Biochemistry and Clinical Chemistry, University of Camerino, I-62032
Camerino Italy
°Institute of Pathology,Palaeopathology Laboratory, Medical School,
University of Pisa, 56126, Pisa, Italy

Key words: HEV, human genome, ancient DNA, reverse transcription, mummy,
anthropological marker.

Abstract
We have analyzed the DNA isolated from well preserved leucocytes adhering to
the surface of a Renaissance (XVI century) band. The results have shown that
the DNA is in the range of 20-200 bp. Sequence analysis of a library of
cloned PCR products allowed us to identify a 24 bp sequence showing 100%
complementarity with the the capsid coding region of the RNA genome of the
hepatitis E virus (HEV). The possible origin of the HEV complementary
sequence is discussed in comparison with that of other viral and non-viral
sequences present in the human genome.

Introduction
The possibility of isolating specific DNA fragments from human remains of
relevant age has widened the scopes of paleopathology (Herrmann & al.,
1994). In particular there have been several attempts to detected the DNA of
pathogenic microorganisms in soft tissues and bone samples(Hummel & al.,
1995). Comparatively less attention has been payed to the molecular
diagnosis of viral infections(van der Kuyl & al., 1992).
The Renaissance mummies of the abbey of S. Domenico Maggiore in Naples have
been the subjects of accurate palaeopathological investigations which have
allowed the researchers to discover two cases of infectious disease,
smallpox and syphilis, and two of neoplastic pathology, skin epithelioma and
colon adenocarcinoma (Fornaciari & al., 1989; Fornaciari & al., 1996;
Fornaciari & al., 1986; Marchetti & al.,1996).
For the last case (Ferrante I of Aragon King of Naples, 1431-1494) the
diagnosis could be confirmed at the molecular level by ancient DNA (aDNA)
analysis (Fornaciari & al., 1989; Fornaciari & al., 1996; Fornaciari &
al., 1986; Marchetti & al.,1996).

One of the most interesting mummies of the S. Domenico Maggiore abbey is
that of Maria of Aragon (1503-1563). At the moment of the exhumation, the
left arm of the mummy presented an oval ulcer covered by a linen dressing.
During a recent survey of the dressing, we have discovered well-preserved
leucocytes adhering to the surface of the linen in correspondence with the
ulcer and we have shown that DNA could be extracted from the ancient
cellular material.
The bandage, a rectangular linen pocket filled with ivy leaves, was wound
around the left arm of the embalmed body of Maria of Aragon and covered a
circular ulcer. Four linen strips sewn at the corners helped keeping the
bandage in position (Fornaciari & al., 1989; Fornaciari & al., 1996;
Fornaciari & al., 1986; Marchetti & al.,1996).
The side of the bandage corresponding to the ulcer was scraped with a razor
blade and the fragments were glued on aluminium trays and vacuum coated
using a sputter coater. The observations were made using a Leica Cambridge
360 scanning electron microscope (SEM).

About 200 mg of dry material scraped from the bandage were ground in a
mortar with a pestle in the presence of 750 ml of an extration medium
containing 1%(w/v) SDS, 50 mM Na2EDTA, 50 mM Tris-HCl (pH 8.0) and 6% (v/v)
water-saturated phenol. The extraction medium was added stepwise to the
sample (three aliquots of 250 µl each). The resulting mixture was vortexed
for 2 min then centrifuged for 2 min (13000 rpm) in a bench-top centrifuge.
The supernatant was transferred in an eppendorf tube and re-extracted using
500 µl of phenol/chloroform/isoamilic alcohol (25/24/1). The supernatant was
submitted to four additional extraction steps, the first using chloroform
and the others using ether. Eventually 40 µl of sodium acetate (2M stock
solution) and 1 ml ethanol were added to the aqueous phase and the
suspension kept at -20 °C for 12 hours. The DNA was precipitated by
centrifugation (13000 rpm) for 10 min. The resulting pellet was drained,
vacuum desiccated for about 15 min and resuspendend in 40 µl distilled
water. To eliminate the polymerase inhibitors, the DNA was purified by
low-temperature agarose gel (2.5%) electrophoresis. The gel (10 x 6.5 x 0.4
cm) was run at 70 V for 1 hour then stained with ethidium bromide and
observed under UV light. The gel was cut into five fragments in
correspondence with the DNA fluorescent smear and the blocks stored at - 25
°C until use.
For PCR (Mullis & al., 1987) amplification, the agarose blocks were melted
at 65 °C and 1 µl of the agarose/DNA suspension directly added to a reaction
mixture (50 µl) containing 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, 50 mM KCl,
0.1 mg/ml gelatin, 200 mM each dATP, dCTP, dTTP, dGTP, 300 ng of each
oligonucleotide primer (5'- GCCTCTAGAAATAGGGGGTA - 3'; 5' -
CGCAGGCTCATCTCTGAGCG - 3') and 2.5 units of Taq polymerase. The thermal
cycler was set as follows (40 cycles): 94 °C for 7 min (initial
denaturation); 94 °C for 30 sec (denaturation); 50 °C for 30 sec
(annealing); 72 °C for 1 min (elongation); 72 °C for 10 min (final
elongation). Amplification controls were performed using agarose blocks cut
outside the DNA smear.
PCR amplified DNA was checked by electrophoresis on 2.5% agarose, then
cloned into a pMOS Blue vector using a T-Vector Kit (Amersham). Individual
clones were sequenced using an ABI Prism 310 Genetic Analyzer (Perkin Elmer)
and a Taq Dye Deoxy Terminator Cycle Sequencing Kit (Perkin Elmer).
Nucleotide sequences obtained from the analysis of the ancient DNA amplicons
were used as query sequences to scan the database of the National Center for
Biotechnology Information (NCBI) using the BLAST (Altschul & al., 1990)
program. Sequences showing similarity were aligned using the Higgins-Sharp
(Clustal 4) function contained in the MAC DNASIS (Hitachi) package.
Figure 1 shows how the desiccated material scraped from the Renaissance band
appears under the SEM. One can observe roundish structures of 7 to 10 mm in
diameter closely resembling necrobiotic leucocytes.

The nucleic acid fraction extracted from the same material is composed by
short DNA fragments ranging from <20 to 200 bp in length (not shown). PCR
amplification of the DNA using the oligonucleotide primers described in the
Material and Methods section produces a relatively sharp band of 90-100 bp
in length. The nucleotide sequences of three pMOS Blue clones (3.5, 3.10,
3.12) of amplified DNA are shown in figure 2ab. All the clones carry very
similar sequence (Fig. 2a). BLAST search into the NCBI database (August
1996: 255,201 nucleotide sequences; 362,357,507 total letters) using the
3.10 clone as the query sequence, shows 100% similarity (complementarity)
between the region encompassing positions 36-59 of the alignment
and the ORF2 (capsid) region (positions 6557-6580) of the hepatitis E virus
(HEV) genome (Mynmar/82 isolate). The region encompassing the positions 2-58
(3.10 clone), on the other hand, shows 80% similarity with the DNA of Homo
sapiens (accession number gb L48708). We can note that the response of the
NCBI search using the 3.10 clone as the query sequence is unambiguous since
in ten times out of ten (accessions: dbj D90274; gbU22532; dbjD10330;
gbM73218; dbjD10333; dbjD10332; gbM80581; gbL08816; gbL25547; dbjD11093) the
sequence is shown to match with the same 24 bp long region of the HEV genome.
HEV is a small, nonenveloped, positive-strand RNA virus of about 30 nm in
diameter. The prototype nucleotide sequence, representing HEV strain
Myanmar/82 is markedly different from those of other viruses (Tam & al.,
1991). Similarity with other viruses can only be detected by comparing amino
acid sequences.The virus is enterically transmitted and the infection occurs
primarily in young to middle-ages adults.

Epidemics have been reported from Asia, the Indian subcontinent, sub-Saharan
Africa and Mexico. The first epidemic of hepatitis E involved 29,000 cases
in Dehli, India, during the 19th century and, possibly, also before that
date (Ticehurst, 1995; Crowford, 1986).
As HEV has no DNA stage and we used no reverse transcriptase in our PCR
assay, the finding of the DNA sequence complementary to HEV ORF2 cannot be
easily explained. We can only list some mechanisms which, in principle,
might be responsible for the production of complementary DNA (cDNA) copy of
a viral mRNA. Retrosequences or retrotranscripts (Li & al., 1992) are
genomic sequences that have been derived through the reverse transcription
of RNA and subsequent integration into the genome, but lack the ability to
produce reverse trascriptase.They equally lack long terminal repeats (LTRs)
and are unable to transpose or to produce virion particles. If a gene is not
transcribed within any germ-line cells, the creation of a retrosequence
requiresthe RNA in order to cross cell barriers. This can happen when an RNA
molecule becomes incapsulated whitin the virion particle of a retrovirus and
is then transported to a germ-line cell where is reverse-transcribed
(Linial, 1987). Regarding our finding, we can make two main hypotesis. The
first, that cDNA copies of by HEV mRNA were produced following the infection of
aria of Aragon by HEV and by a retrovirus. The cDNA copies did not
necessarily require to become integrated into the host genome to become
detectable by our PCR assay.
The physical contiguity of the viral sequence wth a human sequence in the
3.5,3.10 and 3.12 clones could merely be the result of "jumping" during PCR
amplification of aDNA (Pääbo & al., 1990). The second hypotesis is that the
24 bp viral sequence is not directly related to the life and times of Maria
of Aragonbut rather the sequence represents a stable component of the human
genome that was detected for the first time in the course of our survey. We
can note, in this view, that retrosequences (retrogenes and
retropseudogenes) are relatively frequent in the genome of the man and in
that of other mammals. The phenomenon of a locus pumping out defective
copies of itself and disperding them all over the genome has been termed the
"Vesuvian mode of evolution" (Li & al., 1992).

Our finding of the cDNA copy of the HEV genome in the DNA isolated from a
Renaissance mummy poses a number of problems about the origin of the
sequence. At the present we are unable to tell whether the sequence should
be considered a paleopathological marker, possibly indicative of a diffusion
of hepatitis E in Naples during the Renaissance or, conversely, a normal
component of the human genome since very ancient times, though we consider
the second hypothesis more plausible. We suggest that light on this point
could be shed by Southern blot analysis of the basis of the 24 bp viral
sequence as an hybridization probe. Experiments in this sense are going on
in our laboratories.


References
Altschul, S. F., Gish, W., Miller, W., Myers, E. W.& Lipman, D. J., 1990, J.
Mol. Biol. 215, 403 .
Crowford, J. M., in: Pathologic basis of disease (5th edition) p. 831
(Cotran, R. S., Kumar, V., Robbins, S. L.& Schoen, F. J. eds) Filadelfia: W.
B. Saunders Company 1986.
Fornaciari, G., Castagna, M., Tognetti, A., Tornaboni, B.& Bruno, J.: Lancet
8663: 614 (1989).
Fornaciari,G.& Capasso, L., in: Human mummies: a global survey of their
status and the technique of preservation, p. 195. (Spindler,K., Wilfing, H.,
Rastbichler-Zissernig,E., zur Nedden,D., Nothdurfter, H. eds.). Wien:
Springer-Verlag 1996.
Fornaciari, G.& Marchetti,A.:Lancet 8507, 625 (1986).
Herrmann,E. & Hummel, s.: Ancient DNA. Berlin: Springer-Verlag, Berlin 1994.
Hummel, S.& Herrmann, B.: Paleopathol. Newsl. 91 6 (1995).
Linial, M.: Cell 49, 93 (1987).
Marchetti, A., Pellegrini, S., Bevilacqua, G.& Fornaciari, G.: Lancet 9010,
1272 (1996).
Mullis,K.B.& Faloona F. A.: Meth. Enzymol. 155, 335 (1987).
Pääbo, S., Irwin, M.& Wilson, A. C.: J. Biol. Chem. 265, 4718 (1990).
Tam, A. W., Smith, M. M., Guerra, E., Huang, C. C., Bradley, D. W., Fry, K.
E.& Reyes, G. R.: Virology, 185: 120 (1991).
Ticehurst, J., In: Manual of Clinical Microbiology p. 1056 (Murray, P. R.
ed.). Washington: ASM Press 1995.
Van der Kuyl, A.C., Dekker, J., Clutton-Brock, J., Perizonius, W.R.K.&
Goudsmit, J.: Ancient DNA Newsl. 1 , 17 (1992).


Articolo inserito il 28 gennaio 2006 e letto 2882 volte

 
  DEFINIZIONE DI PALEOPATOLOGIA...
ERGONOMIC AND NON-ERGONOMIC DISEASES OF LUIGI...