- Marota, G. Fornaciari°, F. Rollo
Dept. of Molecular, Cell and Animal Biology, School of Specialization in Biochemistry and Clinical Chemistry, University of Camerino, I-62032 Camerino Italy °Institute of Pathology,Palaeopathology Laboratory, Medical School, University of Pisa, 56126, Pisa, Italy
Key words: HEV, human genome, ancient DNA, reverse transcription, mummy, anthropological marker.
Abstract
We have analyzed the DNA isolated from well preserved leucocytes adhering to the surface of a Renaissance (XVI century) band. The results have shown that the DNA is in the range of 20-200 bp. Sequence analysis of a library of cloned PCR products allowed us to identify a 24 bp sequence showing 100% complementarity with the the capsid coding region of the RNA genome of the hepatitis E virus (HEV). The possible origin of the HEV complementary sequence is discussed in comparison with that of other viral and non-viral sequences present in the human genome.
Introduction
The possibility of isolating specific DNA fragments from human remains of relevant age has widened the scopes of paleopathology (Herrmann & al., 1994). In particular there have been several attempts to detected the DNA of pathogenic microorganisms in soft tissues and bone samples(Hummel & al., 1995). Comparatively less attention has been payed to the molecular diagnosis of viral infections(van der Kuyl & al., 1992). The Renaissance mummies of the abbey of S. Domenico Maggiore in Naples have been the subjects of accurate palaeopathological investigations which have allowed the researchers to discover two cases of infectious disease, smallpox and syphilis, and two of neoplastic pathology, skin epithelioma and colon adenocarcinoma (Fornaciari & al., 1989; Fornaciari & al., 1996; Fornaciari & al., 1986; Marchetti & al.,1996). For the last case (Ferrante I of Aragon King of Naples, 1431-1494) the diagnosis could be confirmed at the molecular level by ancient DNA (aDNA) analysis (Fornaciari & al., 1989; Fornaciari & al., 1996; Fornaciari & al., 1986; Marchetti & al.,1996).
One of the most interesting mummies of the S. Domenico Maggiore abbey is that of Maria of Aragon (1503-1563). At the moment of the exhumation, the left arm of the mummy presented an oval ulcer covered by a linen dressing. During a recent survey of the dressing, we have discovered well-preserved leucocytes adhering to the surface of the linen in correspondence with the ulcer and we have shown that DNA could be extracted from the ancient cellular material. The bandage, a rectangular linen pocket filled with ivy leaves, was wound around the left arm of the embalmed body of Maria of Aragon and covered a circular ulcer. Four linen strips sewn at the corners helped keeping the bandage in position (Fornaciari & al., 1989; Fornaciari & al., 1996; Fornaciari & al., 1986; Marchetti & al.,1996). The side of the bandage corresponding to the ulcer was scraped with a razor blade and the fragments were glued on aluminium trays and vacuum coated using a sputter coater. The observations were made using a Leica Cambridge 360 scanning electron microscope (SEM).
About 200 mg of dry material scraped from the bandage were ground in a mortar with a pestle in the presence of 750 ml of an extration medium containing 1%(w/v) SDS, 50 mM Na2EDTA, 50 mM Tris-HCl (pH 8.0) and 6% (v/v) water-saturated phenol. The extraction medium was added stepwise to the sample (three aliquots of 250 µl each). The resulting mixture was vortexed for 2 min then centrifuged for 2 min (13000 rpm) in a bench-top centrifuge. The supernatant was transferred in an eppendorf tube and re-extracted using 500 µl of phenol/chloroform/isoamilic alcohol (25/24/1). The supernatant was submitted to four additional extraction steps, the first using chloroform and the others using ether. Eventually 40 µl of sodium acetate (2M stock solution) and 1 ml ethanol were added to the aqueous phase and the suspension kept at -20 °C for 12 hours. The DNA was precipitated by centrifugation (13000 rpm) for 10 min. The resulting pellet was drained, vacuum desiccated for about 15 min and resuspendend in 40 µl distilled water. To eliminate the polymerase inhibitors, the DNA was purified by low-temperature agarose gel (2.5%) electrophoresis. The gel (10 x 6.5 x 0.4 cm) was run at 70 V for 1 hour then stained with ethidium bromide and observed under UV light. The gel was cut into five fragments in correspondence with the DNA fluorescent smear and the blocks stored at – 25 °C until use. For PCR (Mullis & al., 1987) amplification, the agarose blocks were melted at 65 °C and 1 µl of the agarose/DNA suspension directly added to a reaction mixture (50 µl) containing 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, 50 mM KCl, 0.1 mg/ml gelatin, 200 mM each dATP, dCTP, dTTP, dGTP, 300 ng of each oligonucleotide primer (5′- GCCTCTAGAAATAGGGGGTA – 3′; 5′ – CGCAGGCTCATCTCTGAGCG – 3′) and 2.5 units of Taq polymerase. The thermal cycler was set as follows (40 cycles): 94 °C for 7 min (initial denaturation); 94 °C for 30 sec (denaturation); 50 °C for 30 sec (annealing); 72 °C for 1 min (elongation); 72 °C for 10 min (final elongation). Amplification controls were performed using agarose blocks cut outside the DNA smear. PCR amplified DNA was checked by electrophoresis on 2.5% agarose, then cloned into a pMOS Blue vector using a T-Vector Kit (Amersham). Individual clones were sequenced using an ABI Prism 310 Genetic Analyzer (Perkin Elmer) and a Taq Dye Deoxy Terminator Cycle Sequencing Kit (Perkin Elmer). Nucleotide sequences obtained from the analysis of the ancient DNA amplicons were used as query sequences to scan the database of the National Center for Biotechnology Information (NCBI) using the BLAST (Altschul & al., 1990) program. Sequences showing similarity were aligned using the Higgins-Sharp (Clustal 4) function contained in the MAC DNASIS (Hitachi) package. Figure 1 shows how the desiccated material scraped from the Renaissance band appears under the SEM. One can observe roundish structures of 7 to 10 mm in diameter closely resembling necrobiotic leucocytes.
The nucleic acid fraction extracted from the same material is composed by short DNA fragments ranging from <20 to 200 bp in length (not shown). PCR amplification of the DNA using the oligonucleotide primers described in the Material and Methods section produces a relatively sharp band of 90-100 bp in length. The nucleotide sequences of three pMOS Blue clones (3.5, 3.10, 3.12) of amplified DNA are shown in figure 2ab. All the clones carry very similar sequence (Fig. 2a). BLAST search into the NCBI database (August 1996: 255,201 nucleotide sequences; 362,357,507 total letters) using the 3.10 clone as the query sequence, shows 100% similarity (complementarity) between the region encompassing positions 36-59 of the alignment and the ORF2 (capsid) region (positions 6557-6580) of the hepatitis E virus (HEV) genome (Mynmar/82 isolate). The region encompassing the positions 2-58 (3.10 clone), on the other hand, shows 80% similarity with the DNA of Homo sapiens (accession number gb L48708). We can note that the response of the NCBI search using the 3.10 clone as the query sequence is unambiguous since in ten times out of ten (accessions: dbj D90274; gbU22532; dbjD10330; gbM73218; dbjD10333; dbjD10332; gbM80581; gbL08816; gbL25547; dbjD11093) the sequence is shown to match with the same 24 bp long region of the HEV genome. HEV is a small, nonenveloped, positive-strand RNA virus of about 30 nm in diameter. The prototype nucleotide sequence, representing HEV strain Myanmar/82 is markedly different from those of other viruses (Tam & al., 1991). Similarity with other viruses can only be detected by comparing amino acid sequences.The virus is enterically transmitted and the infection occurs primarily in young to middle-ages adults.
Epidemics have been reported from Asia, the Indian subcontinent, sub-Saharan Africa and Mexico. The first epidemic of hepatitis E involved 29,000 cases in Dehli, India, during the 19th century and, possibly, also before that date (Ticehurst, 1995; Crowford, 1986). As HEV has no DNA stage and we used no reverse transcriptase in our PCR assay, the finding of the DNA sequence complementary to HEV ORF2 cannot be easily explained. We can only list some mechanisms which, in principle, might be responsible for the production of complementary DNA (cDNA) copy of a viral mRNA. Retrosequences or retrotranscripts (Li & al., 1992) are genomic sequences that have been derived through the reverse transcription of RNA and subsequent integration into the genome, but lack the ability to produce reverse trascriptase.They equally lack long terminal repeats (LTRs) and are unable to transpose or to produce virion particles. If a gene is not transcribed within any germ-line cells, the creation of a retrosequence requiresthe RNA in order to cross cell barriers. This can happen when an RNA molecule becomes incapsulated whitin the virion particle of a retrovirus and is then transported to a germ-line cell where is reverse-transcribed (Linial, 1987). Regarding our finding, we can make two main hypotesis. The first, that cDNA copies of by HEV mRNA were produced following the infection of aria of Aragon by HEV and by a retrovirus. The cDNA copies did not necessarily require to become integrated into the host genome to become detectable by our PCR assay. The physical contiguity of the viral sequence wth a human sequence in the 3.5,3.10 and 3.12 clones could merely be the result of “jumping” during PCR amplification of aDNA (Pääbo & al., 1990). The second hypotesis is that the 24 bp viral sequence is not directly related to the life and times of Maria of Aragonbut rather the sequence represents a stable component of the human genome that was detected for the first time in the course of our survey. We can note, in this view, that retrosequences (retrogenes and retropseudogenes) are relatively frequent in the genome of the man and in that of other mammals. The phenomenon of a locus pumping out defective copies of itself and disperding them all over the genome has been termed the “Vesuvian mode of evolution” (Li & al., 1992).
Our finding of the cDNA copy of the HEV genome in the DNA isolated from a Renaissance mummy poses a number of problems about the origin of the sequence. At the present we are unable to tell whether the sequence should be considered a paleopathological marker, possibly indicative of a diffusion of hepatitis E in Naples during the Renaissance or, conversely, a normal component of the human genome since very ancient times, though we consider the second hypothesis more plausible. We suggest that light on this point could be shed by Southern blot analysis of the basis of the 24 bp viral sequence as an hybridization probe. Experiments in this sense are going on in our laboratories.
References
Altschul, S. F., Gish, W., Miller, W., Myers, E. W.& Lipman, D. J., 1990, J. Mol. Biol. 215, 403 . Crowford, J. M., in: Pathologic basis of disease (5th edition) p. 831 (Cotran, R. S., Kumar, V., Robbins, S. L.& Schoen, F. J. eds) Filadelfia: W. B. Saunders Company 1986. Fornaciari, G., Castagna, M., Tognetti, A., Tornaboni, B.& Bruno, J.: Lancet 8663: 614 (1989). Fornaciari,G.& Capasso, L., in: Human mummies: a global survey of their status and the technique of preservation, p. 195. (Spindler,K., Wilfing, H., Rastbichler-Zissernig,E., zur Nedden,D., Nothdurfter, H. eds.). Wien: Springer-Verlag 1996. Fornaciari, G.& Marchetti,A.:Lancet 8507, 625 (1986). Herrmann,E. & Hummel, s.: Ancient DNA. Berlin: Springer-Verlag, Berlin 1994. Hummel, S.& Herrmann, B.: Paleopathol. Newsl. 91 6 (1995). Linial, M.: Cell 49, 93 (1987). Marchetti, A., Pellegrini, S., Bevilacqua, G.& Fornaciari, G.: Lancet 9010, 1272 (1996). Mullis,K.B.& Faloona F. A.: Meth. Enzymol. 155, 335 (1987). Pääbo, S., Irwin, M.& Wilson, A. C.: J. Biol. Chem. 265, 4718 (1990). Tam, A. W., Smith, M. M., Guerra, E., Huang, C. C., Bradley, D. W., Fry, K. E.& Reyes, G. R.: Virology, 185: 120 (1991). Ticehurst, J., In: Manual of Clinical Microbiology p. 1056 (Murray, P. R. ed.). Washington: ASM Press 1995. Van der Kuyl, A.C., Dekker, J., Clutton-Brock, J., Perizonius, W.R.K.& Goudsmit, J.: Ancient DNA Newsl. 1 , 17 (1992).
